Alt-R® CRISPR-Cpf1 genome editing

Ordering
Description
Support
Specifications

CAT#	PRODUCT	SIZE	STORAGE	소비자가	주문
1081068	[IDT] Alt-R A.s. Cas12a (Cpf1) V3, 100 ug	100 ug	-20C	-	로그인
1081069	[IDT] Alt-R A.s. Cas12a (Cpf1) V3, 500 ug	500 ug	-20C	-	로그인
1076300	[IDT] Alt-R Cas12a (Cpf1) Electroporation Enhancer, 2 nmol	2 nmol	RT	-	로그인
1076301	[IDT] Alt-R Cas12a (Cpf1) Electroporation Enhancer, 10 nmol	10 nmol	RT	-	로그인
48075	[IDT] Alt-R CRISPR-Cas12a (Cpf1) crRNA, 2 nmol	2 nmol	RT	-	로그인
48076	[IDT] Alt-R CRISPR-Cas12a (Cpf1)crRNA, 10 nmol	10 nmol	RT	-	로그인

CRISPR-Cas12a (Cpf1) genome editing

Expand your options for genome editing with the Alt-R CRISPR-Cas12a (Cpf1) System

The Alt-R CRISPR-Cas12a (Cpf1) System allows for new CRISPR target sites that are not available with the CRISPR-Cas9 System and produces a staggered cut with a 5′ overhang.

Enables genome editing in organisms with AT-rich genomes
Allows interrogation of additional genomic regions compared to Cas9
Requires simply complexing the crRNA with the Cpf1 protein—no tracrRNA needed
Permits efficient delivery of the RNP into cells by electroporation

Alt-R CRISPR-Cas12a (Cpf1) System

Simple, 2-step delivery of ribonucleoprotein complexes (crRNA:Cpf1)

Alt-R CRISPR-Cpf1 System using ribonucleoprotein electroporation

Figure 1. Overview of Alt-R CRISPR-Cas12a (Cpf1) System experiments for ribonucleoprotein (RNP) delivery by electroporation.

CRISPR-Cas12a (Cpf1) genome editing method uses the Cas12a (Cpf1) endonuclease to generate double-stranded breaks that contain a staggered 5′ overhang. Cas12a (Cpf1) only requires a single CRISPR RNA (crRNA) to specify the DNA target sequence (Figure 1). After cleavage, DNA is then repaired by non-homologous end-joining (NHEJ) or homology-directed recombination (HDR), resulting in a modified sequence. Alt-R CRISPR-Cas12a (Cpf1) reagents provide essential, optimized tools needed to use this pathway for genome editing research. A brief comparison of CRISPR-Cas9 and CRISPR-Cas12a (Cpf1) is provided at the end of this section.

Alt-R CRISPR-Cas12a (Cpf1) System
Required components
Alt-R CRISPR-Cas12a (Cpf1) crRNA	Target-specific RNA oligo, custom synthesized based on your sequence
Alt-R A.s. Cas12a (Cpf1) V3	• Protein that binds the Cpf1 crRNA, creating an experiment-ready, active ribonucleoprotein (RNP) complex • Contains 2 nuclear localization signals (NLSs) for optimal performance
Alt-R Cas12a (Cpf1) Electroporation Enhancer	Cpf1-specific carrier DNA required for efficient electroporation of the RNP

Related reagents and kits
Cas12a (Cpf1) positive controls	Order as custom crRNAs or oligos • HPRT crRNAs (human, mouse, or rat): To show that Cas12a (Cpf1) editing is occurring in your system during experimental optimization or troubleshooting • HPRT PCR primers (human, mouse, or rat): To detect genome editing in experiments with HPRT crRNAs; for use with the Alt-R Genome Editing Detection Kit
Alt-R Genome Editing Detection Kit	For mutation detection and estimating editing efficiency

Components for genome editing

Cas12a (Cpf1) endonuclease from Acidaminococcus sp. BV3L6 along with a crRNA is capable of mediating genome editing in mammalian cells (Figure 2). The Alt-R CRISPR-Cas12a (Cpf1) System includes 3 main components: an optimized crRNA, A.s. Cas12a (Cpf1) endonuclease, and an electroporation enhancer. While electroporation of Cas12a (Cpf1) endonuclease as part of an RNP is the preferred method, the Alt-R CRISPR-Cpf1 crRNA is also compatible with A.s. Cas12a (Cpf1) from any source, including cells that stably express A.s. Cas12a (Cpf1) endonuclease.

CRISPR editing with Cpf1 protein and crRNA

Figure 2. Components of the Alt-R CRISPR-Cas12a (Cpf1) System for directing Cas12a (Cpf1) endonuclease to genomic targets. Alt-R Cas12a (Cpf1) crRNA forms a complex with Cas12a (Cpf1) endonuclease to guide targeted cleavage of genomic DNA. The cleavage site is specified by the protospacer element of the crRNA (thick green bar). The crRNA protospacer element recognizes 21 nt on the opposite strand of the TTTV PAM site. The PAM site must be present immediately upstream of the protospacer element for cleavage to occur. PAM = protospacer adjacent motif; V = A, C, or G

Alt-R CRISPR-Cas12a (Cpf1) crRNA and design tips

The Alt-R CRISPR-Cas12a (Cpf1) crRNA is a single, 40–44 base, guide RNA, comprised of a 20 base constant region (loop domain) and a 20–24 base target-specific region (protospacer domain). We typically recommend a 21 base protospacer domain for optimal activity. All Alt-R CRISPR-Cas12a (Cpf1) crRNAs are synthesized with proprietary chemical modifications, which protect the crRNA from degradation by cellular RNases and further improve on-target editing performance.

For crRNAs used with A.s. Cas12a (Cpf1), identify locations in your target region with the protospacer adjacent motif (PAM) sequence, TTTV, where V is A, C, or G. Your Alt-R CRISPR-Cas12a (Cpf1) crRNA will bind to the DNA strand opposite to the PAM sequence (Figure 2). Do not include the PAM sequence in your crRNA design. An example of a correct crRNA sequence is shown in Figure 3.

Once you enter your 20–24 base target sequence, 20 additional bases and the necessary modifications will automatically be added by the order entry system for a total of 40–44 RNA bases. These additional bases and modifications are necessary to create a complete Alt-R CRISPR-Cas12a (Cpf1) crRNA. The system will also convert the final sequence to RNA—enter DNA bases only into the ordering tool (Figure 3).

Figure 3. How to enter your Cas12a (Cpf1) crRNA target sequence. Because the crRNA recognizes and binds 21 bases on the DNA strand opposite from the TTTV sequence of the PAM site, order your crRNA by entering the 20–24 bases downstream of the PAM site, in the forward orientation as shown. Enter only DNA bases into the order entry tool. If you are pasting your CRISPR target site from an online design tool, make sure you verify the correct strand orientation. Do not include the PAM site in your design. Common incorrect design examples are shown in red. PAM = protospacer adjacent motif; V = A, C, or G

Alt-R A.s. Cas12a (Cpf1) V3

Alt-R A.s. Cas12a (Cpf1) V3 enzyme is a high purity, recombinant Acidaminococcus sp. Cas12a (Cpf1). The enzyme includes 1 N-terminal nuclear localization sequence (NLS) and 1 C-terminal NLSs, as well as 3 N-terminal FLAG tags and a C-terminal 6-His tag. The Cas12a (Cpf1) enzyme must be combined with a crRNA to produce a functional, target-specific editing complex. For the best editing, combine Alt-R A.s. Cas12a (Cpf1) V3 enzyme with optimized Alt-R CRISPR-Cas12a (Cpf1) crRNA in equimolar amounts.

In contrast to Streptococcus pyogenes Cas9, which recognizes an NGG PAM sequence, the A.s. Cas12a (Cpf1) PAM sequence is TTTV, which permits targeting of DNA sequences in AT-rich regions of the genome.

Product specifications:

Alt-R A.s. Cas12a (Cpf1) V3

Amount provided: 100 µg or 500 µg
Molecular weight: 156,400 g/mol
Concentration: 10 µg/µL in 50% glycerol, [63 µM]
Endotoxin tested: <2 EU/mg
Shipping conditions: dry ice
Storage conditions: –20°C

Alt-R Cpf1 Electroporation Enhancer

The Alt-R Cpf1 Electroporation Enhancer is a Cpf1-specific carrier DNA that is optimized to work with the Amaxa^® Nucleofector^® device (Lonza) and the Neon^® Transfection System (Thermo Fisher) for increased transfection efficiency and therefore, increased genome editing efficiency.

Positive controls

crRNAs

Positive control crRNAs can be used to show that Cpf1 editing is occurring in your experiments, which can be useful when you are optimizing RNP delivery conditions or if you need to troubleshoot your experiments.

IDT scientists have designed and tested positive control crRNAs targeting HPRT. To order, copy and paste the appropriate sequence in the Cas12a (Cpf1) crRNA ordering page:

Human HPRT1, Cpf1 Positive Control crRNA: GGTTAAAGATGGTTAAATGAT

Mouse Hprt, Cpf1 Positive Control crRNA: GGATGTTAAGAGTCCCTATCT

Rat Hprt1, Cpf1 Positive Control crRNA: ACCGCCCCCCCCATACCCCAA

Attention: Unlike S. pyogenes Cas12a (Cpf1) V3, which cleaves most potential NGG PAM sites to some degree, some of the tested TTTV sites show no cleavage by A.s. Cas12a (Cpf1) V3. We recommend using positive control crRNAs to establish that your cells can be edited by Cpf1. In addition, we suggest testing 3 or more crRNAs per target gene.

PCR primers

IDT scientists have also designed and tested PCR primers (Alt-R HPRT PCR Primer Mixes for human, mouse, or rat) for use with the Alt-R Genome Editing Detection Kit to detect editing or estimate editing efficiency in samples transfected with the positive control HPRT crRNAs.

Negative controls

Negative control crRNAs are important for showing that transfection of the RNP complex is not responsible for observed phenotypes. Amplification of DNA from these negative control samples with your experimental primers and cycling conditions should result in only full-length products with the Alt-R Genome Editing Detection Kit (i.e., in a T7EI assay). Note, that this result does not rule out off-target effects of your experimental crRNA.

IDT scientists have computationally designed and tested negative control crRNAs to be non-targeting in human, mouse, and rat genomes. To order, copy and paste the appropriate sequence in the Cpf1 crRNA ordering page:

Cas12a (Cpf1) Negative Control crRNA #1: CGTTAATCGCGTATAATACGG

Cas12a (Cpf1) Negative Control crRNA #2: CATATTGCGCGTATAGTCGCG

Cas12a (Cpf1) Negative Control crRNA #3: GGCGCGTATAGTCGCGCGTAT

Comparison of CRISPR genome editing using Cas9 vs. Cas12a (Cpf1)

	Cas9 system	Cas12a (Cpf1) system
Applications	General genome editing	• For species with AT-rich genomes • For regions with limiting design space for use of the CRISPR-Cas9 system
Ribonucleoprotein components	• crRNA • tracrRNA • Cas9 endonuclease	• crRNA • Cpf1 endonuclease
crRNA	• Native: 42 nt • Alt-R: 35–36 nt (36 nt recommended)	• Native: 42–44 nt • Alt-R: 40–44 nt (41 nt recommended)
tracrRNA	• Native: 89 nt • Alt-R: 67 nt	(not applicable)
CRISPR enzyme	• Class 2, Cas type II • M.W.*: 162,200 g/mol • Endonuclease domains: RuvC-like and HNH	• Class 2, Cas type V • M.W.*: 156,400 g/mol • Endonuclease domain: RuvC-like only
Double-stranded DNA cleavage	• Blunt ended cut 3 bases upstream of the protospacer sequence • PAM site often destroyed during genome editing	• 5′ overhanging cut on the 5′ side of the protospacer sequence • PAM site may be preserved after genome editing
PAM sequence^†	NGG	TTTV
Current recommendations for Alt-R RNP delivery	• Lipid-mediated transfection • Electroporation ± Alt-R enhancer • Microinjection	• Electroporation with Alt-R enhancer • Microinjection

* Molecular weight of Alt-R nuclease
^† N = any base; V = A, C, or G

PAM sites for Cas12a (Cpf1) include TTTA, TTTC, and TTTG

Unlike S. pyogenes Cas9, which cleaves most NGG PAM sites to some degree, A.s. Cpf1 nuclease has a lower rate of cleavage for the Cas12a (Cpf1) PAM sequence. IDT scientists have found that crRNAs that have TTTA, TTTC, and TTTG PAM sequences are more likely to be functional compared to crRNAs that have TTTT as a PAM sequence.

We recommend using positive control crRNAs to establish that your cells can be edited by Cas12a (Cpf1). In addition, we suggest testing 3 or more crRNAs per target gene using TTTV (i.e., TTTA, TTTC, and TTTG) as your PAM site.

Cpf1 PAM site is TTTV (i.e., TTTA, TTTC, TTTG)

Figure 1. Maximize successful CRISPR-Cas12a (Cpf1) genome editing by using TTTA, TTTC, or TTTG as the PAM site. HEK-293 cells were transfected with ribonucleoprotein (RNP: Alt-R A.s. Cas12a (Cpf1) V3 complexed with Alt-R CRISPR-Cas12a (Cpf1) crRNA) as instructed in the Alt-R CRISPR-Cas12a (Cpf1) User Guide—RNP electroporation, Amaxa^® Nucleofector^® system (available at www.idtdna.com/CRISPR-Cpf1). TTTN sites from 6 genes were used to design 232 Alt-R CRISPR-Cas12a (Cpf1) crRNAs. Editing efficiency was determined 48 hr after electroporation using the Alt-R Genome Editing Detection Kit, which provides the major components required for T7EI endonuclease assays. PAM = protospacer adjacent motif (Cas12a (Cpf1) PAM sequence is TTTV, where V = A, C, or G); N = any base

The electroporation enhancer is required for efficient genome editing with the CRISPR-Cas12a (Cpf1) system

We have found that some of the Cas12a (Cpf1) PAM sequences are not active sites for genome editing. We recommend that you test 3 or more PAM sites in your region of interest and include the Alt-R Cas12a (Cpf1) Electroporation Enhancer for efficient genome editing. The enhancer is a non-targeting carrier DNA that shows no integration into the target site based on next generation sequencing experiments.

Alt-R CRISPR-Cpf1 Electroporation Enhancer is required for RNP electroporation

Figure 2. Alt-R Cas12a (Cpf1) Electroporation Enhancer is required for efficient CRISPR editing in ribonucleoprotein (RNP) electroporation experiments. HEK-293 cells were transfected with 5 µM RNP (Alt-R A.s. Cas12a (Cpf1) V3 complexed with Alt-R CRISPR-Cas12a (Cpf1) crRNA) as instructed in the Alt-R CRISPR-Cpf1 User Guide—RNP electroporation, Amaxa^® Nucleofector^® system (available at www.idtdna.com/CRISPR-Cpf1). 12 Cpf1 PAM sites in the HPRT gene were targeted by Alt-R CRISPR-Cas12a (Cpf1)crRNAs. The electroporation reactions contained either no (dark blue) or 3 µM (light blue) Alt-R Cas12a (Cpf1) Electroporation Enhancer. Editing efficiency was determined 48 hr after electroporation using the Alt-R Genome Editing Detection Kit, which provides the major components required for T7EI assays. PAM = protospacer adjacent motif (Cpf1 PAM sequence is TTTV); x-axis: numbers specify gene locations; S = sense strand; AS = antisense strand.

Optimizing Cas12a (Cpf1) crRNA length improves gene editing performance

Systematic variation of crRNA length led to the development of the Alt-R CRISPR-Cas12a (Cpf1) crRNA, which shows improved gene editing in mammalian cells. Overall, crRNAs containing 21 nt protospacers provided the highest editing efficiency at most target sites (Figure 3). On-target activity was drastically reduced when protospacer lengths shorter than 20 nt were used (data not shown).

CRISPR-Cpf1 crRNA with 21mer protospacer length provide optimal editing activity

Figure 3. crRNA with 21mer protospacer lengths provides optimal on-target genome editing. Varying lengths of crRNAs targeting HPRT were reverse transfected using Lipofectamine^® RNAiMAX™ reagent (Thermo Fisher), into a HEK-293–Cpf1 cell line that stably expresses Acidaminococcus sp.Cpf1. Genomic DNA was isolated, and genome editing was measured using the Alt-R Genome Editing Detection Kit (T7EI assay) and Fragment Analyzer™ (Advanced Analytical).

Positive control: CRISPR editing (Human, mouse, or rat HPRT)

Confirm that your CRISPR editing conditions are working by using positive control crRNAs. The results from positive control experiments are important for research publications and provide useful information, should you need to troubleshoot your experiments. (Sequences for crRNAs that target HPRT in human, mouse, or rat are available through the Alt-R CRISPR-Cas12a (Cpf1) crRNA ordering tool.)

To monitor genome editing in your positive control samples, use the Alt-R Genome Editing Detection Kit and CRISPR Control Primer Mixes (human, mouse, or rat).

T7EI digestion of CRISPR-Cpf1 HPRT positive controls

Figure 4. Sample data from T7 endonuclease I (T7EI) assays of samples transfected with Cas12a (Cpf1) HPRT Positive Controls. Genomic DNA from CRISPR-Cas12a (Cpf1) edited human, mouse, and rat HPRT controls were PCR amplified, digested using T7EI, and run on the Fragment Analyzer™ system (Advanced Analytical Technologies, Inc.). Reference standard bands at 5000 bp (upper marker) and 35 bp (lower marker) are used to align the gel and analyze the results. Estimated band sizes for the cut and uncut positive control amplicons are listed in the table. Cell lines used were HEK-293 (human), Hepa1-6 (mouse), and RG2 (rat). PCR annealing temperatures for human and mouse primers is 67°C and for rat primers is 64°C.

사용 후기: 사용후기가 없습니다.

사용후기 작성