MBIOTECH.CO.KR : IDT > miRNA Analysis

miRCat® Small RNA Cloning Kit

Description

miRCat^® Small RNA Cloning Kit

miRCat^®small RNA cloning kit는 pre-activated, adenylated RNA linkering 방법에 근거한 것으로 어떤 종에서 유래된 어떤 RNA source로부터도 클로닝이 가능하게 합니다. miRCat-33^® kit는 5' ligation-independent small RNA cloning을 수행하기 위한 목적으로 miRCat^®kit 를 변형한 것입니다.

miRCat^® Small RNA Cloning Kit

miRCat^® kit에는 10번의 클로닝 실험을 할 수 있는 양이 들어 있습니다.

miRCat^® small RNA cloning is based upon the pre-activated, adenylated RNA linking method that has been used successfully in many labs since its development in 2001 [1]. This method permits cloning from any RNA source in any species. The miRCat-33^®Conversion Kit allows the miRCat Kit to be used for 5′ ligation-independent small RNA cloning using the method of Pak and Fire [2].

Description	Part #
miRCat® RNA Cloning Kit	11-02-06-02

Material sufficient for ten cloning experiments is provided in the miRCat™ kit.

Kit Contents:

3′ Linker 1 pre-activated, adenylated cloning linker
5′ M.R.S. cloning linker
miSPIKE 21-mer internal RNA control
Forward and Reverse/RT primers
T4 RNA Ligase
Ligation buffer w/o ATP
Ligation Enhancer
10mM ATP
T4 DNA Ligase
3M NaOAc (pH 5.2)
10mg/ml Glycogen
IDTE (pH 7.5)
IDT Water
Technical Manual
Edge Biosystems Gel Purification Columns

Figure 1. The Process of Cloning miRNAs and Other Small RNAs from any Total RNA Source Using the miRCat^®Kit. The Ban I restriction enzyme sites in the cloning linkers are shown by cross hatching. The page numbers indicate the pages in the full length manual where each step of the protocol begins.
The Ban I restriction enzyme sites in the cloning linkers are shown by cross hatching. The page numbers indicate the pages in the full length manual where each step of the protocol begins.

References

Bartel DP (2004) MicroRNAs: genomics, biogenesis, mechanism, and function. Cell, 116(2):281–97.
Lee RC, Feinbaum RL, and Ambros V (1993) The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell, 75(5):843–54.

miRCat-33^® Conversion Kit

Each oligo pack contains:

3′ pre-activated, adenylated cloning linker
Sequence- 5′- rAppTGGAATTCTCGGGTGCCAAGG/ddC/ -3′
Replacement PCR Primer
Sequence- 5′- CCTTGGCACCCGAGAATT -3′

Description	Part #
1 nm miRCat®-33 Conversion Oligo Pack	51-01-13-09
5 nm miRCat®-33 Conversion Oligos Pack	51-01-13-10

miRCat-33^® is a conversion of the miRCat^® kit for the purpose of carrying out 5′ ligation-independent small RNA cloning using the method of Pak and Fire [1]. Primer is included at no charge.

References

Lee RC, Feinbaum RL, and Ambros V (1993) The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell, 75(5):843–54.

454 miRCat^® and miRCat-33^® Adapter Primers

454 Adaptor Primers are designed to convert the small RNA libraries generated by miRCat ligations (Set I) or by miRCat-33 ligations (Set II) into 454-compatible PCR libraries for deep sequencing [1].

References

Denli AM, et al. (2004) Processing of primary microRNAs by the Microprocessor complex. Nature, 432(7014):231–5.

사용 후기: 사용후기가 없습니다.

사용후기 작성

miRCat® Small RNA Cloning Kit

Kit Contents:

References

miRCat-33® Conversion Kit

Each oligo pack contains:

References

454 miRCat® and miRCat-33® Adapter Primers

References

miRCat^® Small RNA Cloning Kit

miRCat-33^® Conversion Kit

454 miRCat^® and miRCat-33^® Adapter Primers