miRCat Small RNA Cloning Kit

miRCat Small RNA Cloning Kit

miRCat small RNA cloning kit pre-activated, adenylated RNA linkering ٰ   RNA sourceκ͵ Ŭδ ϰ մϴ. miRCat-33 kit 5' ligation-independent small RNA cloning ϱ miRCat kit Դϴ.
miRCat  Small RNA Cloning Kit
miRCat  kit 10 Ŭδ ִ ֽϴ.
miRCat small RNA cloning is based upon the pre-activated, adenylated RNA linking method that has been used successfully in many labs since its development in 2001 [1]. This method permits cloning from any RNA source in any species. The miRCat-33 Conversion Kit allows the miRCat Kit to be used for 5 ligation-independent small RNA cloning using the method of Pak and Fire [2]. 
    Description Part #
    miRCat RNA Cloning Kit 11-02-06-02
    Material sufficient for ten cloning experiments is provided in the miRCat kit.

    Kit Contents:

    • 3 Linker 1 pre-activated, adenylated cloning linker
    • 5 M.R.S. cloning linker
    • miSPIKE 21-mer internal RNA control
    • Forward and Reverse/RT primers
    • T4 RNA Ligase
    • Ligation buffer w/o ATP
    • Ligation Enhancer
    • 10mM ATP
    • T4 DNA Ligase
    • 3M NaOAc (pH 5.2)
    • 10mg/ml Glycogen
    • IDTE (pH 7.5)
    • IDT Water
    • Technical Manual
    • Edge Biosystems Gel Purification Columns
    miRCat Kit.jpg
    Figure 1. The Process of Cloning miRNAs and Other Small RNAs from any Total RNA Source Using the miRCat Kit. The Ban I restriction enzyme sites in the cloning linkers are shown by cross hatching. The page numbers indicate the pages in the full length manual where each step of the protocol begins.
    The Ban I restriction enzyme sites in the cloning linkers are shown by cross hatching. The page numbers indicate the pages in the full length manual where each step of the protocol begins.


    1. Bartel DP (2004) MicroRNAs: genomics, biogenesis, mechanism, and function. Cell, 116(2):281–97.
    2. Lee RC, Feinbaum RL, and Ambros V (1993) The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell, 75(5):843–54.

    miRCat-33 Conversion Kit

    Each oligo pack contains:

    • 3 pre-activated, adenylated cloning linker
      Sequence- 5- rAppTGGAATTCTCGGGTGCCAAGG/ddC/ -3
    • Replacement PCR Primer
      Sequence- 5- CCTTGGCACCCGAGAATT -3
    Description Part #
    1 nm miRCat-33 Conversion Oligo Pack 51-01-13-09
    5 nm miRCat-33 Conversion Oligos Pack 51-01-13-10  
    miRCat-33 is a conversion of the miRCat kit for the purpose of carrying out 5 ligation-independent small RNA cloning using the method of Pak and Fire [1]. Primer is included at no charge.


    1. Lee RC, Feinbaum RL, and Ambros V (1993) The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell, 75(5):843–54.

    454 miRCat and miRCat-33 Adapter Primers

    454 Adaptor Primers are designed to convert the small RNA libraries generated by miRCat ligations (Set I) or by miRCat-33 ligations (Set II) into 454-compatible PCR libraries for deep sequencing [1].


    1. Denli AM, et al. (2004) Processing of primary microRNAs by the Microprocessor complex. Nature, 432(7014):231–5.

    ıⰡ ϴ.
    ı ۼ